rna substrates Search Results


nsun2fl fl creert mice  (TargetMol)
94
TargetMol nsun2fl fl creert mice
Nsun2fl Fl Creert Mice, supplied by TargetMol, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+substrates/NSUN2+Protein%2C+Human%2C+Recombinant/pm41816830-337-17-24
Average 94 stars, based on 1 article reviews
nsun2fl fl creert mice - by Bioz Stars, 2026-10
94/100 stars
  Buy from Supplier
rna substrates trmd (synthetic trnaleu: 5′-gcgaagguggcggaauugguagac gcgcuagcuucagg uguuaguguccuuacggacguggggg uucaaguccccccccucgcacca-3′  (GenScript corporation)
90
GenScript corporation rna substrates trmd (synthetic trnaleu: 5′-gcgaagguggcggaauugguagac gcgcuagcuucagg uguuaguguccuuacggacguggggg uucaaguccccccccucgcacca-3′
Rna Substrates Trmd (Synthetic Trnaleu: 5′ Gcgaagguggcggaauugguagac Gcgcuagcuucagg Uguuaguguccuuacggacguggggg Uucaaguccccccccucgcacca 3′, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+substrates/rna+substrates+trmd++synthetic+trnaleu++5++gcgaagguggcggaauugguagac+gcgcuagcuucagg+uguuaguguccuuacggacguggggg+uucaaguccccccccucgcacca+3+/pm39900960-210-0-17
Average 90 stars, based on 1 article reviews
rna substrates trmd (synthetic trnaleu: 5′-gcgaagguggcggaauugguagac gcgcuagcuucagg uguuaguguccuuacggacguggggg uucaaguccccccccucgcacca-3′ - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
double-stranded rna/dna substrate  (Matos labs)
90
Matos labs double-stranded rna/dna substrate
Double Stranded Rna/Dna Substrate, supplied by Matos labs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+substrates/double+stranded+rna+dna+substrate/pmc03981172-92-11-19
Average 90 stars, based on 1 article reviews
double-stranded rna/dna substrate - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
5′-[m7gppp]guagaacuucgucgaguacgcucaa[fam]-3  (Bio-Synthesis Inc)
90
Bio-Synthesis Inc 5′-[m7gppp]guagaacuucgucgaguacgcucaa[fam]-3
5′ [M7gppp]Guagaacuucgucgaguacgcucaa[Fam] 3, supplied by Bio-Synthesis Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+substrates/substrate+rna++seq+id+23++5++guagaacuucgucgaguacgcucaa+fam++3+/pm31197197-160-1-5
Average 90 stars, based on 1 article reviews
5′-[m7gppp]guagaacuucgucgaguacgcucaa[fam]-3 - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
fluorogenic rna oligonucleotide substrate 5′6–fam–darudada–6–tamra3′  (GenScript corporation)
90
GenScript corporation fluorogenic rna oligonucleotide substrate 5′6–fam–darudada–6–tamra3′
Fluorogenic Rna Oligonucleotide Substrate 5′6–Fam–Darudada–6–Tamra3′, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+substrates/fluorogenic+rna+oligonucleotide+substrate+5+6+fam+darudada+6+tamra3+/pmc12102731-185-1-11
Average 90 stars, based on 1 article reviews
fluorogenic rna oligonucleotide substrate 5′6–fam–darudada–6–tamra3′ - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
are1-fl rna substrate  (PROTEINA Co Ltd)
90
PROTEINA Co Ltd are1-fl rna substrate
Are1 Fl Rna Substrate, supplied by PROTEINA Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+substrates/are1+fl+rna+substrate/pm40147776-368-17-20
Average 90 stars, based on 1 article reviews
are1-fl rna substrate - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
fluorescently labeled rna substrates  (GenScript corporation)
90
GenScript corporation fluorescently labeled rna substrates
Assessment of RNase activity of MazF-Sa, PemK-Sa1, PemK-Sa6, and mutants against different <t>substrates.</t> ( A ) PemK-Sa6 and its E19R and F42T mutants do not exhibit detectable activity against phage MS2 <t>RNA.</t> Very low activity is observed for the double mutant. PemK-Sa1 displays a strong RNase activity. ( B ) RNase activity of PemK-Sa6 toxin and its mutants against <t>fluorescently</t> labeled oligo RNAs. PemK-Sa6 single mutants as well as PemK-Shae are enzymatically inactive. Double-mutant PemK-Sa6 (E19R + F42T) shows activity comparable to PemK-Sa1. ( C ) RNase activity of PemK-Sa1 and MazF-Sa against cat194 transcripts containing indicated numbers of target sequences (UAUU and UACAU, respectively). MazF-Sa displays residual unspecific activity visible as digestion of transcripts devoid of target UACAU sites.
Fluorescently Labeled Rna Substrates, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+substrates/short+fluorescently+labeled+rna+substrates/pmc11915791-298-0-5
Average 90 stars, based on 1 article reviews
fluorescently labeled rna substrates - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
radiolabeled substrate rna solution containing 0.3 u/ll rnasin  (Promega)
90
Promega radiolabeled substrate rna solution containing 0.3 u/ll rnasin
Assessment of RNase activity of MazF-Sa, PemK-Sa1, PemK-Sa6, and mutants against different <t>substrates.</t> ( A ) PemK-Sa6 and its E19R and F42T mutants do not exhibit detectable activity against phage MS2 <t>RNA.</t> Very low activity is observed for the double mutant. PemK-Sa1 displays a strong RNase activity. ( B ) RNase activity of PemK-Sa6 toxin and its mutants against <t>fluorescently</t> labeled oligo RNAs. PemK-Sa6 single mutants as well as PemK-Shae are enzymatically inactive. Double-mutant PemK-Sa6 (E19R + F42T) shows activity comparable to PemK-Sa1. ( C ) RNase activity of PemK-Sa1 and MazF-Sa against cat194 transcripts containing indicated numbers of target sequences (UAUU and UACAU, respectively). MazF-Sa displays residual unspecific activity visible as digestion of transcripts devoid of target UACAU sites.
Radiolabeled Substrate Rna Solution Containing 0.3 U/Ll Rnasin, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+substrates/radiolabeled+substrate+rna+solution+containing+0+3+u+ll+rnasin/pm21053045-78-21-22
Average 90 stars, based on 1 article reviews
radiolabeled substrate rna solution containing 0.3 u/ll rnasin - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
5′-gpppagaaccug-biotin-teg-3  (TriLink)
90
TriLink 5′-gpppagaaccug-biotin-teg-3
Assessment of RNase activity of MazF-Sa, PemK-Sa1, PemK-Sa6, and mutants against different <t>substrates.</t> ( A ) PemK-Sa6 and its E19R and F42T mutants do not exhibit detectable activity against phage MS2 <t>RNA.</t> Very low activity is observed for the double mutant. PemK-Sa1 displays a strong RNase activity. ( B ) RNase activity of PemK-Sa6 toxin and its mutants against <t>fluorescently</t> labeled oligo RNAs. PemK-Sa6 single mutants as well as PemK-Shae are enzymatically inactive. Double-mutant PemK-Sa6 (E19R + F42T) shows activity comparable to PemK-Sa1. ( C ) RNase activity of PemK-Sa1 and MazF-Sa against cat194 transcripts containing indicated numbers of target sequences (UAUU and UACAU, respectively). MazF-Sa displays residual unspecific activity visible as digestion of transcripts devoid of target UACAU sites.
5′ Gpppagaaccug Biotin Teg 3, supplied by TriLink, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+substrates/rna+substrate+5++gpppagaaccug+biotin+teg+3/pmc03057852-287-10-14
Average 90 stars, based on 1 article reviews
5′-gpppagaaccug-biotin-teg-3 - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
gel-purified rna substrates  (Promega)
90
Promega gel-purified rna substrates
Assessment of RNase activity of MazF-Sa, PemK-Sa1, PemK-Sa6, and mutants against different <t>substrates.</t> ( A ) PemK-Sa6 and its E19R and F42T mutants do not exhibit detectable activity against phage MS2 <t>RNA.</t> Very low activity is observed for the double mutant. PemK-Sa1 displays a strong RNase activity. ( B ) RNase activity of PemK-Sa6 toxin and its mutants against <t>fluorescently</t> labeled oligo RNAs. PemK-Sa6 single mutants as well as PemK-Shae are enzymatically inactive. Double-mutant PemK-Sa6 (E19R + F42T) shows activity comparable to PemK-Sa1. ( C ) RNase activity of PemK-Sa1 and MazF-Sa against cat194 transcripts containing indicated numbers of target sequences (UAUU and UACAU, respectively). MazF-Sa displays residual unspecific activity visible as digestion of transcripts devoid of target UACAU sites.
Gel Purified Rna Substrates, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+substrates/gel+purified+rna+substrates/pm12403832-232-2-50
Average 90 stars, based on 1 article reviews
gel-purified rna substrates - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
50-fluorescein-labeled rna substrates  (Shanghai GenePharma)
90
Shanghai GenePharma 50-fluorescein-labeled rna substrates
Assessment of RNase activity of MazF-Sa, PemK-Sa1, PemK-Sa6, and mutants against different <t>substrates.</t> ( A ) PemK-Sa6 and its E19R and F42T mutants do not exhibit detectable activity against phage MS2 <t>RNA.</t> Very low activity is observed for the double mutant. PemK-Sa1 displays a strong RNase activity. ( B ) RNase activity of PemK-Sa6 toxin and its mutants against <t>fluorescently</t> labeled oligo RNAs. PemK-Sa6 single mutants as well as PemK-Shae are enzymatically inactive. Double-mutant PemK-Sa6 (E19R + F42T) shows activity comparable to PemK-Sa1. ( C ) RNase activity of PemK-Sa1 and MazF-Sa against cat194 transcripts containing indicated numbers of target sequences (UAUU and UACAU, respectively). MazF-Sa displays residual unspecific activity visible as digestion of transcripts devoid of target UACAU sites.
50 Fluorescein Labeled Rna Substrates, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+substrates/50+fluorescein+labeled+rna+substrates/pm28332713-67-1-6
Average 90 stars, based on 1 article reviews
50-fluorescein-labeled rna substrates - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
rna substrate  (Promega)
90
Promega rna substrate
Assessment of RNase activity of MazF-Sa, PemK-Sa1, PemK-Sa6, and mutants against different <t>substrates.</t> ( A ) PemK-Sa6 and its E19R and F42T mutants do not exhibit detectable activity against phage MS2 <t>RNA.</t> Very low activity is observed for the double mutant. PemK-Sa1 displays a strong RNase activity. ( B ) RNase activity of PemK-Sa6 toxin and its mutants against <t>fluorescently</t> labeled oligo RNAs. PemK-Sa6 single mutants as well as PemK-Shae are enzymatically inactive. Double-mutant PemK-Sa6 (E19R + F42T) shows activity comparable to PemK-Sa1. ( C ) RNase activity of PemK-Sa1 and MazF-Sa against cat194 transcripts containing indicated numbers of target sequences (UAUU and UACAU, respectively). MazF-Sa displays residual unspecific activity visible as digestion of transcripts devoid of target UACAU sites.
Rna Substrate, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+substrates/rna+substrate/pm16861794-42-3-21
Average 90 stars, based on 1 article reviews
rna substrate - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

Image Search Results


Assessment of RNase activity of MazF-Sa, PemK-Sa1, PemK-Sa6, and mutants against different substrates. ( A ) PemK-Sa6 and its E19R and F42T mutants do not exhibit detectable activity against phage MS2 RNA. Very low activity is observed for the double mutant. PemK-Sa1 displays a strong RNase activity. ( B ) RNase activity of PemK-Sa6 toxin and its mutants against fluorescently labeled oligo RNAs. PemK-Sa6 single mutants as well as PemK-Shae are enzymatically inactive. Double-mutant PemK-Sa6 (E19R + F42T) shows activity comparable to PemK-Sa1. ( C ) RNase activity of PemK-Sa1 and MazF-Sa against cat194 transcripts containing indicated numbers of target sequences (UAUU and UACAU, respectively). MazF-Sa displays residual unspecific activity visible as digestion of transcripts devoid of target UACAU sites.

Journal: mSystems

Article Title: Analysis of co-occurrence of type II toxin–antitoxin systems and antibiotic resistance determinants in Staphylococcus aureus

doi: 10.1128/msystems.00957-24

Figure Lengend Snippet: Assessment of RNase activity of MazF-Sa, PemK-Sa1, PemK-Sa6, and mutants against different substrates. ( A ) PemK-Sa6 and its E19R and F42T mutants do not exhibit detectable activity against phage MS2 RNA. Very low activity is observed for the double mutant. PemK-Sa1 displays a strong RNase activity. ( B ) RNase activity of PemK-Sa6 toxin and its mutants against fluorescently labeled oligo RNAs. PemK-Sa6 single mutants as well as PemK-Shae are enzymatically inactive. Double-mutant PemK-Sa6 (E19R + F42T) shows activity comparable to PemK-Sa1. ( C ) RNase activity of PemK-Sa1 and MazF-Sa against cat194 transcripts containing indicated numbers of target sequences (UAUU and UACAU, respectively). MazF-Sa displays residual unspecific activity visible as digestion of transcripts devoid of target UACAU sites.

Article Snippet: Short fluorescently labeled RNA substrates (GenScript) contained 6-carboxyfluorescein (6-FAM) at the 5′-end and 5-carboxytetramethylrhodamine (5-TAMRA) at the 3′-end.

Techniques: Activity Assay, Mutagenesis, Labeling