rna substrates Search Results


90
Fasmac Co Ltd 50-end fluorescein-5isothiocyanate (fitc)-labeled substrate rna
50 End Fluorescein 5isothiocyanate (Fitc) Labeled Substrate Rna, supplied by Fasmac Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/50-end fluorescein-5isothiocyanate (fitc)-labeled substrate rna/product/Fasmac Co Ltd
Average 90 stars, based on 1 article reviews
50-end fluorescein-5isothiocyanate (fitc)-labeled substrate rna - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Glen Research nucleic acid substrates—rspacer (introducing abasic h4folate rna lesions)
Nucleic Acid Substrates—Rspacer (Introducing Abasic H4folate Rna Lesions), supplied by Glen Research, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nucleic acid substrates—rspacer (introducing abasic h4folate rna lesions)/product/Glen Research
Average 90 stars, based on 1 article reviews
nucleic acid substrates—rspacer (introducing abasic h4folate rna lesions) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Mimetics nsp15 rna substrate
PDB ID: 6VWW Global Symmetry top view: arrows indicate the proposed RNA substrate mimetics as ligands and competitive inhibitors of the <t>nsp15</t> monomers. Crystal structure adapted from Kim et al. .
Nsp15 Rna Substrate, supplied by Mimetics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nsp15 rna substrate/product/Mimetics
Average 90 stars, based on 1 article reviews
nsp15 rna substrate - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Fasmac Co Ltd 32p-labeled 21-mer rna substrate inosine (50- cuguaugaugiagaugcugac-30
PDB ID: 6VWW Global Symmetry top view: arrows indicate the proposed RNA substrate mimetics as ligands and competitive inhibitors of the <t>nsp15</t> monomers. Crystal structure adapted from Kim et al. .
32p Labeled 21 Mer Rna Substrate Inosine (50 Cuguaugaugiagaugcugac 30, supplied by Fasmac Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/32p-labeled 21-mer rna substrate inosine (50- cuguaugaugiagaugcugac-30/product/Fasmac Co Ltd
Average 90 stars, based on 1 article reviews
32p-labeled 21-mer rna substrate inosine (50- cuguaugaugiagaugcugac-30 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Creative Biogene Inc dna–rna hybrid substrate (5′fam-darudada-tamra-3′)
PDB ID: 6VWW Global Symmetry top view: arrows indicate the proposed RNA substrate mimetics as ligands and competitive inhibitors of the <t>nsp15</t> monomers. Crystal structure adapted from Kim et al. .
Dna–Rna Hybrid Substrate (5′Fam Darudada Tamra 3′), supplied by Creative Biogene Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dna–rna hybrid substrate (5′fam-darudada-tamra-3′)/product/Creative Biogene Inc
Average 90 stars, based on 1 article reviews
dna–rna hybrid substrate (5′fam-darudada-tamra-3′) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
GenScript corporation short fluorescently labeled rna substrates
PDB ID: 6VWW Global Symmetry top view: arrows indicate the proposed RNA substrate mimetics as ligands and competitive inhibitors of the <t>nsp15</t> monomers. Crystal structure adapted from Kim et al. .
Short Fluorescently Labeled Rna Substrates, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/short fluorescently labeled rna substrates/product/GenScript corporation
Average 90 stars, based on 1 article reviews
short fluorescently labeled rna substrates - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
GenScript corporation rna substrates trmd (synthetic trna leu : 5′-gcgaagguggcggaauugguagacgcgcuagcuucagg uguuaguguccuuacggacguggggguucaaguccccccccucgcacca-3′
A , B MST traces of the METTL3/14 enzyme reaction incubated with variable concentrations of SAM yielded significant thermophoresis shifts and enabled the determination of the Michaelis-Menten constant K M . C Inhibitor characterization of STM2457: MST-derived dose-response curves. D , E MST traces and substrate conversion plots (F norm vs time) revealing initial S. aureus <t>TrmD</t> kinetics. F Inhibitor characterization of 5-phenylthieno[2,3- d ]pyrimidin-4(1 H )-one: MST-derived dose-response curves. All inhibitor characterizations were performed in triplicates (mean ± SD, n = 3).
Rna Substrates Trmd (Synthetic Trna Leu : 5′ Gcgaagguggcggaauugguagacgcgcuagcuucagg Uguuaguguccuuacggacguggggguucaaguccccccccucgcacca 3′, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rna substrates trmd (synthetic trna leu : 5′-gcgaagguggcggaauugguagacgcgcuagcuucagg uguuaguguccuuacggacguggggguucaaguccccccccucgcacca-3′/product/GenScript corporation
Average 90 stars, based on 1 article reviews
rna substrates trmd (synthetic trna leu : 5′-gcgaagguggcggaauugguagacgcgcuagcuucagg uguuaguguccuuacggacguggggguucaaguccccccccucgcacca-3′ - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
GenScript corporation rna substrate 5′6-fam-aaauaa-3′6-tamra
A , B MST traces of the METTL3/14 enzyme reaction incubated with variable concentrations of SAM yielded significant thermophoresis shifts and enabled the determination of the Michaelis-Menten constant K M . C Inhibitor characterization of STM2457: MST-derived dose-response curves. D , E MST traces and substrate conversion plots (F norm vs time) revealing initial S. aureus <t>TrmD</t> kinetics. F Inhibitor characterization of 5-phenylthieno[2,3- d ]pyrimidin-4(1 H )-one: MST-derived dose-response curves. All inhibitor characterizations were performed in triplicates (mean ± SD, n = 3).
Rna Substrate 5′6 Fam Aaauaa 3′6 Tamra, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rna substrate 5′6-fam-aaauaa-3′6-tamra/product/GenScript corporation
Average 90 stars, based on 1 article reviews
rna substrate 5′6-fam-aaauaa-3′6-tamra - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Mimetics rna substrate mimetics
PDB ID: 6VWW Global Symmetry top view: arrows indicate the proposed <t>RNA</t> <t>substrate</t> mimetics as ligands and competitive inhibitors of the nsp15 monomers. Crystal structure adapted from Kim et al. .
Rna Substrate Mimetics, supplied by Mimetics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rna substrate mimetics/product/Mimetics
Average 90 stars, based on 1 article reviews
rna substrate mimetics - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Sangon Biotech 34-nt unlabelled rna substrate
PDB ID: 6VWW Global Symmetry top view: arrows indicate the proposed <t>RNA</t> <t>substrate</t> mimetics as ligands and competitive inhibitors of the nsp15 monomers. Crystal structure adapted from Kim et al. .
34 Nt Unlabelled Rna Substrate, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/34-nt unlabelled rna substrate/product/Sangon Biotech
Average 90 stars, based on 1 article reviews
34-nt unlabelled rna substrate - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
IBA GmbH substrate rna
PDB ID: 6VWW Global Symmetry top view: arrows indicate the proposed <t>RNA</t> <t>substrate</t> mimetics as ligands and competitive inhibitors of the nsp15 monomers. Crystal structure adapted from Kim et al. .
Substrate Rna, supplied by IBA GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/substrate rna/product/IBA GmbH
Average 90 stars, based on 1 article reviews
substrate rna - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
TriLink rna substrate (5'-gpppagaaccug-biotin-teg-3)
PDB ID: 6VWW Global Symmetry top view: arrows indicate the proposed <t>RNA</t> <t>substrate</t> mimetics as ligands and competitive inhibitors of the nsp15 monomers. Crystal structure adapted from Kim et al. .
Rna Substrate (5' Gpppagaaccug Biotin Teg 3), supplied by TriLink, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rna substrate (5'-gpppagaaccug-biotin-teg-3)/product/TriLink
Average 90 stars, based on 1 article reviews
rna substrate (5'-gpppagaaccug-biotin-teg-3) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results


PDB ID: 6VWW Global Symmetry top view: arrows indicate the proposed RNA substrate mimetics as ligands and competitive inhibitors of the nsp15 monomers. Crystal structure adapted from Kim et al. .

Journal: Future Drug Discovery

Article Title: Overcoming nonstructural protein 15-nidoviral uridylate-specific endoribonuclease (nsp15/NendoU) activity of SARS-CoV-2

doi: 10.4155/fdd-2020-0012

Figure Lengend Snippet: PDB ID: 6VWW Global Symmetry top view: arrows indicate the proposed RNA substrate mimetics as ligands and competitive inhibitors of the nsp15 monomers. Crystal structure adapted from Kim et al. .

Article Snippet: Here, we describe a novel hypothetical approach: combining available broad-spectrum antiviral agents such as nucleoside analogs with potential inhibitors of NendoU, for example nsp15 RNA substrate mimetics.

Techniques:

A , B MST traces of the METTL3/14 enzyme reaction incubated with variable concentrations of SAM yielded significant thermophoresis shifts and enabled the determination of the Michaelis-Menten constant K M . C Inhibitor characterization of STM2457: MST-derived dose-response curves. D , E MST traces and substrate conversion plots (F norm vs time) revealing initial S. aureus TrmD kinetics. F Inhibitor characterization of 5-phenylthieno[2,3- d ]pyrimidin-4(1 H )-one: MST-derived dose-response curves. All inhibitor characterizations were performed in triplicates (mean ± SD, n = 3).

Journal: Communications Chemistry

Article Title: A microscale thermophoresis-based enzymatic RNA methyltransferase assay enables the discovery of DNMT2 inhibitors

doi: 10.1038/s42004-025-01439-9

Figure Lengend Snippet: A , B MST traces of the METTL3/14 enzyme reaction incubated with variable concentrations of SAM yielded significant thermophoresis shifts and enabled the determination of the Michaelis-Menten constant K M . C Inhibitor characterization of STM2457: MST-derived dose-response curves. D , E MST traces and substrate conversion plots (F norm vs time) revealing initial S. aureus TrmD kinetics. F Inhibitor characterization of 5-phenylthieno[2,3- d ]pyrimidin-4(1 H )-one: MST-derived dose-response curves. All inhibitor characterizations were performed in triplicates (mean ± SD, n = 3).

Article Snippet: RNA substrates for TrmD (synthetic tRNA Leu : 5′-GCGAAGGUGGCGGAAUUGGUAGACGCGCUAGCUUCAGG UGUUAGUGUCCUUACGGACGUGGGGGUUCAAGUCCCCCCCCUCGCACCA-3′) and METTL3/14 (5′-AACUUAAUGUUGCAUUGGACUUGAGUUA-3′) were obtained commercially (GenScript).

Techniques: Incubation, Derivative Assay

PDB ID: 6VWW Global Symmetry top view: arrows indicate the proposed RNA substrate mimetics as ligands and competitive inhibitors of the nsp15 monomers. Crystal structure adapted from Kim et al. .

Journal: Future Drug Discovery

Article Title: Overcoming nonstructural protein 15-nidoviral uridylate-specific endoribonuclease (nsp15/NendoU) activity of SARS-CoV-2

doi: 10.4155/fdd-2020-0012

Figure Lengend Snippet: PDB ID: 6VWW Global Symmetry top view: arrows indicate the proposed RNA substrate mimetics as ligands and competitive inhibitors of the nsp15 monomers. Crystal structure adapted from Kim et al. .

Article Snippet: This raises the possibility of a novel approach where RNA substrate mimetics of nsp15 can be deployed as endonuclease inhibitors.

Techniques: