|
Fasmac Co Ltd
50-end fluorescein-5isothiocyanate (fitc)-labeled substrate rna 50 End Fluorescein 5isothiocyanate (Fitc) Labeled Substrate Rna, supplied by Fasmac Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/50-end fluorescein-5isothiocyanate (fitc)-labeled substrate rna/product/Fasmac Co Ltd Average 90 stars, based on 1 article reviews
50-end fluorescein-5isothiocyanate (fitc)-labeled substrate rna - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Glen Research
nucleic acid substrates—rspacer (introducing abasic h4folate rna lesions) Nucleic Acid Substrates—Rspacer (Introducing Abasic H4folate Rna Lesions), supplied by Glen Research, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/nucleic acid substrates—rspacer (introducing abasic h4folate rna lesions)/product/Glen Research Average 90 stars, based on 1 article reviews
nucleic acid substrates—rspacer (introducing abasic h4folate rna lesions) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Mimetics
nsp15 rna substrate ![]() Nsp15 Rna Substrate, supplied by Mimetics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/nsp15 rna substrate/product/Mimetics Average 90 stars, based on 1 article reviews
nsp15 rna substrate - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Fasmac Co Ltd
32p-labeled 21-mer rna substrate inosine (50- cuguaugaugiagaugcugac-30 ![]() 32p Labeled 21 Mer Rna Substrate Inosine (50 Cuguaugaugiagaugcugac 30, supplied by Fasmac Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/32p-labeled 21-mer rna substrate inosine (50- cuguaugaugiagaugcugac-30/product/Fasmac Co Ltd Average 90 stars, based on 1 article reviews
32p-labeled 21-mer rna substrate inosine (50- cuguaugaugiagaugcugac-30 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Creative Biogene Inc
dna–rna hybrid substrate (5′fam-darudada-tamra-3′) ![]() Dna–Rna Hybrid Substrate (5′Fam Darudada Tamra 3′), supplied by Creative Biogene Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/dna–rna hybrid substrate (5′fam-darudada-tamra-3′)/product/Creative Biogene Inc Average 90 stars, based on 1 article reviews
dna–rna hybrid substrate (5′fam-darudada-tamra-3′) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
short fluorescently labeled rna substrates ![]() Short Fluorescently Labeled Rna Substrates, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/short fluorescently labeled rna substrates/product/GenScript corporation Average 90 stars, based on 1 article reviews
short fluorescently labeled rna substrates - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
rna substrates trmd (synthetic trna leu : 5′-gcgaagguggcggaauugguagacgcgcuagcuucagg uguuaguguccuuacggacguggggguucaaguccccccccucgcacca-3′ ![]() Rna Substrates Trmd (Synthetic Trna Leu : 5′ Gcgaagguggcggaauugguagacgcgcuagcuucagg Uguuaguguccuuacggacguggggguucaaguccccccccucgcacca 3′, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rna substrates trmd (synthetic trna leu : 5′-gcgaagguggcggaauugguagacgcgcuagcuucagg uguuaguguccuuacggacguggggguucaaguccccccccucgcacca-3′/product/GenScript corporation Average 90 stars, based on 1 article reviews
rna substrates trmd (synthetic trna leu : 5′-gcgaagguggcggaauugguagacgcgcuagcuucagg uguuaguguccuuacggacguggggguucaaguccccccccucgcacca-3′ - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
rna substrate 5′6-fam-aaauaa-3′6-tamra ![]() Rna Substrate 5′6 Fam Aaauaa 3′6 Tamra, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rna substrate 5′6-fam-aaauaa-3′6-tamra/product/GenScript corporation Average 90 stars, based on 1 article reviews
rna substrate 5′6-fam-aaauaa-3′6-tamra - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Mimetics
rna substrate mimetics ![]() Rna Substrate Mimetics, supplied by Mimetics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rna substrate mimetics/product/Mimetics Average 90 stars, based on 1 article reviews
rna substrate mimetics - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Sangon Biotech
34-nt unlabelled rna substrate ![]() 34 Nt Unlabelled Rna Substrate, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/34-nt unlabelled rna substrate/product/Sangon Biotech Average 90 stars, based on 1 article reviews
34-nt unlabelled rna substrate - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
IBA GmbH
substrate rna ![]() Substrate Rna, supplied by IBA GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/substrate rna/product/IBA GmbH Average 90 stars, based on 1 article reviews
substrate rna - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
TriLink
rna substrate (5'-gpppagaaccug-biotin-teg-3) ![]() Rna Substrate (5' Gpppagaaccug Biotin Teg 3), supplied by TriLink, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rna substrate (5'-gpppagaaccug-biotin-teg-3)/product/TriLink Average 90 stars, based on 1 article reviews
rna substrate (5'-gpppagaaccug-biotin-teg-3) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Future Drug Discovery
Article Title: Overcoming nonstructural protein 15-nidoviral uridylate-specific endoribonuclease (nsp15/NendoU) activity of SARS-CoV-2
doi: 10.4155/fdd-2020-0012
Figure Lengend Snippet: PDB ID: 6VWW Global Symmetry top view: arrows indicate the proposed RNA substrate mimetics as ligands and competitive inhibitors of the nsp15 monomers. Crystal structure adapted from Kim et al. .
Article Snippet: Here, we describe a novel hypothetical approach: combining available broad-spectrum antiviral agents such as nucleoside analogs with potential inhibitors of NendoU, for
Techniques:
Journal: Communications Chemistry
Article Title: A microscale thermophoresis-based enzymatic RNA methyltransferase assay enables the discovery of DNMT2 inhibitors
doi: 10.1038/s42004-025-01439-9
Figure Lengend Snippet: A , B MST traces of the METTL3/14 enzyme reaction incubated with variable concentrations of SAM yielded significant thermophoresis shifts and enabled the determination of the Michaelis-Menten constant K M . C Inhibitor characterization of STM2457: MST-derived dose-response curves. D , E MST traces and substrate conversion plots (F norm vs time) revealing initial S. aureus TrmD kinetics. F Inhibitor characterization of 5-phenylthieno[2,3- d ]pyrimidin-4(1 H )-one: MST-derived dose-response curves. All inhibitor characterizations were performed in triplicates (mean ± SD, n = 3).
Article Snippet:
Techniques: Incubation, Derivative Assay
Journal: Future Drug Discovery
Article Title: Overcoming nonstructural protein 15-nidoviral uridylate-specific endoribonuclease (nsp15/NendoU) activity of SARS-CoV-2
doi: 10.4155/fdd-2020-0012
Figure Lengend Snippet: PDB ID: 6VWW Global Symmetry top view: arrows indicate the proposed RNA substrate mimetics as ligands and competitive inhibitors of the nsp15 monomers. Crystal structure adapted from Kim et al. .
Article Snippet: This raises the possibility of a novel approach where
Techniques: